52214

MOLECULAR DIVERSITY OF ENDOPHYTIC FUNGI ISOLATED FROM Aristolochia triangularis Cham.

Favoritar este trabalho

Endophytic fungi have been widely studied due their capability to produce bioactive compounds wich have several applications on industry, agriculture and medicine. Many of these are products of mimicry of metabolites produced by their hosts. For this reason, know this comunity is very important on plants with medicinal approaches. Aristolochia triangularis is largely used in brasilian folk medicine due its properties that includes anti-inflammatory action, antiseptic, emmenagogue and antipyretic. Its used to treat diseases as rheumatism, wounds, skin diseases, among others. Thus, in this work, we evaluated the molecular diversity of endophytic fungi isolated from A. triangularis. First, we proceeded the isolation of culturable fungal endophytes from vine, fruit, stem, adult and young leaves from plants grown in Atlantic Forest region (Almirante Tamandaré, PR, Brazil). We obtained two hundred and sixty two isolates. After DNA extraction a about eight hundred basepair amplicon was obtained by PCR of internal transcribed spacer (ITS) region of ribossomal DNA (V9G-F:ttacgtccctgccctttgta; LS266-R:gcattcccaaacaactcgactc). After that, we did a amplified ribossomal DNA restriction analyses (ARDRA), using Mbo I and Hae III according to the manufacturer. We grouped those isolates who present equal profile in both enzymatic analyses. A binary matrix was made and ploted on dendro UPGMA software, to built a dendrogram, showing 28 different haplotypes profiles. This data leads us to believe that diversity of fungal endophytes in this plant is very large, including inside the groups, once some of them have more than fifty isolates. Shannon diversity index (H') was calculated and indicate that vine have greater diversity of isolates (H' = 2.3393), followed by stem (H' = 1.8843), young leaves (H' = 1.6756), adult leaves (H' = 1.8415) and fruit (H' = 1.3718). As next steps, we will sequencing some isolates from each group, to evaluate the diversity of species presents in A. triangulares.